Comments on Quiz 2

  • Depicting inversions in DOTLET work, because the program is rather intelligent (it also compares eiach window tot the inverse complement). Usually this does not work in a strict window comparison, because the inverted sequence is the inverse complement that is not similar to the original sequence!

    5' AGTCGTATGCGCGCGGCCTTAA
    3' TCAGCATACGCGCGCCGGAATT
             ------->

    After inversion of the central portion (lower case) :

             <-------
    5' AGTCGTgcgcgcatGGCCTTAA
    3' TCAGCAcgcgcgtaCCGGAATT

    Aside: In which order are sequences usually given? (nucleotides, amino acids?) (answer in order of their biosynthesis :))

    Test: seq1 seq1 with inversion (inverse complement created using this web based program) - DOTLET
  • Databank searches and alignments: if possible use protein.
     
  • The rho termination factor and the V-ATPase Asubunit are an example for the transitive property of homology. The central portion of both has significant similarity to the flagellar assembly ATPase. See table here.

 

Questions on Quiz 3?

Possible topics for discussion:
optimal versus unique alignment;
What is the impact of gap penalties?
What is the maximum sequence divergence?
 
Which types of RNA do you know?

Types of Errors in Blast searches

False positives: their probability is accurately assessed through the E or P-values
              (aka Type I error)
False negatives (homologous sequences present in the databank that were not detected) - we know there are a huge number of homologs that are not identified in a blast search, but the exact number is very difficult to estimate. (If there were only 2000 distinct families of protein folds, then on average every search should retrieve about 0.05% of the databank

Trees:

  • Topology and Branchlengths
  • Rooted vs Unrooted
  • Root, outgroups and the root of the tree of life
  • Branches, splits, bipartitions
  • In a rooted tree: clades
  • Mono-, Para-, polyphyletic groups, cladists and a natural taxonomy
  • Shared derived versus primitive characters (Synapomorphy, Sympleisiomorphy, Autapomorphy, homoplasy)
  • shared derived

The existence of the RNA world as a transitory stage is supported by the following:

  • RNA molecules have catalytic activity. Famous ribozymes are the group I self splicing intron from Tetrahymena (ciliate) and the RNA portion of the E.coli Ribonuclease P (involved in tRNA processing)

  • RNA molecules have the potential to function as genetic material and as enzymes, or ribozymes (this solves the chicken vs. egg problem). This also allows for comparatively easy schemes to evolve RNAs in vitro to have new or different catalytic function (blind design by evolution).

  • Many enzymatic cofactors are nucleotides or nucleotide derived (FAD, ATP). Ribosomal protein synthesis relies on RNAs. RNA is an important part of the catalytic machinery that forms the peptide bond (see Noller et al.), tRNAs contain many strange bases suggesting that the catalytic potential of RNA molecules can go beyond what is possible with four bases only.

In vitro evolution has succeeded to evolving RNA's with novel properties, e.g. ATP binding. Jack Szostak's lab is working to evolve RNAs with template directed RNA polymerization capabilities. The principle selection scheme is depicted in this diagram at Szostak's web page.

In vitro selection became famous with Sol Spiegelman's experiments on the vitro replication of the Phage Qbeta RNA. In this case selection was for the fastest replicating molecules - they become shorter and lost their ability to infect bacteria.

Later inventions are the SELEX procedure to select for RNA with very specific binding properties (see left), and the selection of ribozymes with altered or new properties. In the latter case growth and selection can be either discrete or continuous. See reading materials for further discussion.

How can evolution be improved?

Genetic drift or the co-selection of slightly deleterious mutations lead to the fixation of deleterious mutations. These mutations can be eliminated if recombination occurs between different members of the population. Another advantage of recombination is that positive properties that arose independently in different parts of the molecules can be combined by recombination, molecular breeding, and sexual PCR.

Illustration for the power of recombination: Molecular Computation -> the traveling salesman problem Adleman's Science paper (JSTORE link)

In vitro evolution of proteins
Problem:
How to couple the functional protein to the genetic material.

Biological solution: cells contain the genetic material and the encoded proteins. Selection of cell that contain the more successful protein, will also select the gene encoding the protein.

Alternative: Link protein to encoding RNA. (see O'Keefe and Szostak's scheme h on RNA display here)

In higher Eukaryotes the coding sequence is often interrupted by introns. Genes are transcribed into RNA. With the help of so-called spliceosomes the introns are removed from the RNA and the exon portions are religated. In Arabidopsis the splice site consensus is as follows (from www.arabidopsis.org):

(This table summarizes the sequences surrounding the intron splice sites in the plant Arabidopsis. E.g., in 52.9% of the intron exon boundaries (bottom part) the first base of the exon is a G, and in 40.5% the next nucletides is a T.)

Given the many introns known in Arabidopsis , and the fact that many of the spliceosomal RNAs have been sequenced, one might expect that given a sequence it would be possible to recognize with high reliability which parts of a sequence are coding. The following exercises will demonstrate that this is not the case. More on introns is here.

 

Reading assignment:

For FRIDAY
Quiz#3!

Fold a paper-crane to use as flag to get the attention of your TA/instructor in the computer lab. Write your name on the wings. (Move it on top of your computer, if you have a question.)

Read chapter 8 for Monday.